Stem-loop sequence osa-MIR1875

AccessionMI0008278 (change log)
DescriptionOryza sativa miR1875 stem-loop
Literature search

1 open access papers mention osa-MIR1875
(1 sentences)

Stem-loop
   gc   c      ca        ug            a   acauu     a aacg    c a         c       c     ug ug     --au   uuaac      cu    --     u 
5'   ugu cauuuu  uugcacuu  cuccauuguggu uug     cugca g    aguc c guaucaagu acuguua ggugu  u  guacc    uga     auaaca  ugac  ggcca a
     ||| ||||||  ||||||||  |||||||||||| |||     ||||| |    |||| | ||||||||| ||||||| |||||  |  |||||    |||     ||||||  ||||  |||||  
3'   aca guaaag  aacgugaa  gagguaacacca agc     gacgu c    ucag g cauaguuua ugacaau ucacg  g  caugg    acu     uauugu  guug  cuggu c
   uu   a      ac        gu            a   gaguu     - -gga    u a         u       u     gu ua     agac   ucgac      au    ua     u 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 17567947-17568198 [-]
intergenic
Database links

Mature sequence osa-miR1875

Accession MIMAT0007829
Sequence

220 - 

acaauggagugaagugcaacagaa

 - 243

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).