Stem-loop sequence osa-MIR1873

AccessionMI0008276 (change log)
DescriptionOryza sativa miR1873 stem-loop
Literature search

5 open access papers mention osa-MIR1873
(6 sentences)

Stem-loop
   u  au      c                          c    ---------    gacauc   a    cug     gg      -c  ug  --aa  -u       
5'  ag  uaugaa cucaacaugguaucagagcuggaagu cuaa         aguu      aug uagc   acgau  uggaga  ca  au    gc  gauacc 
    ||  |||||| |||||||||||||||||||||||||| ||||         ||||      ||| ||||   |||||  ||||||  ||  ||    ||  ||||| a
3'  uc  guauuu gaguuguaccauagucucgaucuuca gauu         ucaa      uac aucg   uguua  accucu  gu  ua    cg  uuaugu 
   -  cg      u                          a    caaaaagau    --acac   -    ---     ga      uu  gu  cagc  uu       
Get sequence
Deep sequencing
392 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 12755913-12756109 [+]
intergenic
Database links

Mature sequence osa-miR1873

Accession MIMAT0007826
Sequence

14 - 

ucaacaugguaucagagcuggaag

 - 37

Get sequence
Deep sequencing302 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).