Stem-loop sequence osa-MIR1871

AccessionMI0008274 (change log)
DescriptionOryza sativa miR1871 stem-loop
Literature search

6 open access papers mention osa-MIR1871
(17 sentences)

Stem-loop
   ua        -      u  ug    uc     u                u      g guagccau 
5'   acaaugaa uauauc gu  uuuc  ucaaa cuaacaugguaucgga ccauag u        a
     |||||||| |||||| ||  ||||  ||||| |||||||||||||||| |||||| |        u
3'   uguuacuu auauag ca  aaag  aguuu gguuguacuauagucu gguauc a        c
   -a        u      u  gu    ga     u                c      g aauucuaa 
Get sequence
Deep sequencing
224 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 13330464-13330598 [+]
intergenic
Database links

Mature sequence osa-miR1871

Accession MIMAT0007824
Sequence

82 - 

auggcucugauaucauguugguuu

 - 105

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).