Stem-loop sequence osa-MIR1869

AccessionMI0008272 (change log)
DescriptionOryza sativa miR1869 stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop
   --     a         a  a            guauu      a acagg   a      gac    aau 
5'   aagga caccugaga ca uaggcaugggag     gggaaa c     aac uauugu   cccu   u
     ||||| ||||||||| || ||||||||||||     |||||| |     ||| ||||||   ||||    
3'   uuucu guggauucu gu auccguacccuu     uccuuu g     uug guaaua   ggga   u
   uu     c         c  a            guacc      c --gag   -      -aa    aau 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21644852-21644989 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1869
osa-MIR2118aChr4: 21642923-21643101 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
Database links

Mature sequence osa-miR1869

Accession MIMAT0007822
Sequence

11 - 

ugagaacaauaggcaugggaggua

 - 34

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).