Stem-loop sequence osa-MIR812f

AccessionMI0008271 (change log)
DescriptionOryza sativa miR812f stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812f
(16 sentences)

Stem-loop
   -          -                             ua        a   uuaauauuuuuauuguuauuagauuauaaaacaca 
5'  caugaguuuu gugucuaacuuugaucguccguuuuauuu  aauuuuuu uga                                   a
    |||||||||| |||||||||||||||||||||||||||||  |||||||| |||                                   a
3'  guacuuaaag cacagguugaaauuaguaggcaaaauaaa  uuaaaaaa acu                                   u
   g          g                             --        a   uuuuugauuucuuguauucaguguguauuucauga 
Get sequence
Deep sequencing
1498 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 13243503-13243681 [+]
intergenic
Database links

Mature sequence osa-miR812f

Accession MIMAT0007821
Sequence

146 - 

acggaugauuaaaguuggacacgg

 - 169

Get sequence
Deep sequencing1204 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).