Stem-loop sequence osa-MIR1868

AccessionMI0008270 (change log)
DescriptionOryza sativa miR1868 stem-loop
Literature search

4 open access papers mention osa-MIR1868
(4 sentences)

Stem-loop
   gg    gc       --       ua    ac       a       cuc                c      gg   ugu  u 
5'   aaag  uuuguaa  aacacac  uuug  aguuugg aagcgug   acggaaaacgagggag agccaa  cau   uc u
     ||||  |||||||  |||||||  ||||  ||||||| |||||||   |||||||||||||||| ||||||  |||   || a
3'   uuuc  aaacguu  uugugug  aaau  ucgagcc uucgcac   ugccuuuugcuccuuc ucgguu  gua   gg c
   ua    aa       cu       gc    cu       c       aaa                a      aa   uuu  c 
Get sequence
Deep sequencing
852 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 19715448-19715616 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1868
osa-MIR1423Chr4: 19715117-19715252 [+]
osa-MIR1868Chr4: 19715448-19715616 [+]
Database links

Mature sequence osa-miR1868

Accession MIMAT0007820
Sequence

47 - 

ucacggaaaacgagggagcagcca

 - 70

Get sequence
Deep sequencing789 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).