Stem-loop sequence osa-MIR1866

AccessionMI0008267 (change log)
DescriptionOryza sativa miR1866 stem-loop
Literature search

1 open access papers mention osa-MIR1866
(1 sentences)

Stem-loop
   -      -c   g                     cg      g 
5'  cuuuug  acg agggauuuugcgggaauuuca  ggaauu a
    ||||||  ||| |||||||||||||||||||||  |||||| g
3'  ggaaac  ugu uucuuaaaauguccuuaaagu  ccuuag u
   a      cu   g                     --      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 6510870-6510954 [+]
intergenic
Database links

Mature sequence osa-miR1866-5p

Accession MIMAT0007817
Previous IDsosa-miR1866
Sequence

11 - 

gagggauuuugcgggaauuucacg

 - 34

Get sequence
Evidence experimental; 454 [1]

Mature sequence osa-miR1866-3p

Accession MIMAT0009212
Sequence

52 - 

ugaaauuccuguaaaauucuug

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).