Stem-loop sequence osa-MIR1865

AccessionMI0008266 (change log)
DescriptionOryza sativa miR1865 stem-loop
Literature search

4 open access papers mention osa-MIR1865
(4 sentences)

Stem-loop
   --c     c   u         g              ca  a  c       u ug    ---        -  g 
5'    ucgaa uac gcuagugau gugauucuucgaca  gu uu ggcgagu u  ggcu   ucaucaug cg u
      ||||| ||| ||||||||| ||||||||||||||  || || ||||||| |  ||||   |||||||| || g
3'    aguuu aug ugaucacug cgcuaagaagcugu  ca aa ccguuca a  ccga   agugguac gc c
   cuc     a   u         a              --  g  a       - gu    agc        a  u 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 34000594-34000737 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1865
osa-MIR1865Chr3: 34000594-34000737 [+]
osa-MIR5513Chr3: 34008003-34008148 [+]
Database links

Mature sequence osa-miR1865-5p

Accession MIMAT0007815
Sequence

11 - 

ugcuagugauggugauucuucgac

 - 34

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence osa-miR1865-3p

Accession MIMAT0007816
Sequence

111 - 

cgaagaaucgcagucacuaguugu

 - 134

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).