Stem-loop sequence osa-MIR1864

AccessionMI0008265 (change log)
DescriptionOryza sativa miR1864 stem-loop
Literature search

2 open access papers mention osa-MIR1864
(2 sentences)

Stem-loop
   -                            cca      aga    a    ug     a      c            ag aggcggguuugaccggugggagggggcuuugaccguucuuugaccgaa 
5'  acuacacauugaccaucgcguuacuacg   uucuug   gacg gaau  aaaag gguggg guggggggaggu  c                                                g
    ||||||||||||||||||||||||||||   ||||||   |||| ||||  ||||| |||||| ||||||||||||  |                                                u
3'  ugauguguaacugguagugcaaugaugu   aaggac   cugu uuug  uuuuc ccaccc caccccccucca  g                                                g
   a                            uac      --g    g    gu     c      a            ga aguacccgguuggguggagggggagggaucccggguuuuggguggagg 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 14949073-14949328 [-]
intergenic
Database links

Mature sequence osa-miR1864

Accession MIMAT0007814
Sequence

227 - 

uuguaguaacgugauggucaaugu

 - 250

Get sequence
Deep sequencing63 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).