Stem-loop sequence osa-MIR1863a

AccessionMI0008264 (change log)
Previous IDsosa-MIR1863
DescriptionOryza sativa miR1863 stem-loop
Literature search

4 open access papers mention osa-MIR1863a
(10 sentences)

Stem-loop
   --c      u                  c             aguugcucuuguucccucaaucccguuugucuccauccacaaccacacgagugcaaagccucacauucaugucaacaacaacucucaugucauuagcaaaucuagugucuagcaucaacaccuagguagcacuuauugguuaaaa 
5'    cauauc cuagucuaauaugguauc gagcuuauugguu                                                                                                                                                 a
      |||||| |||||||||||||||||| |||||||||||||                                                                                                                                                  
3'    guauag gauuagauuguaccauag cucgaauaaccag                                                                                                                                                 g
   ucc      u                  u             aagggguaugacguugaaacgauugguuauaaaucacuguuuggaagguaguguuguaauaauaacguucgugguuucgcguguauaacaguucguagguuugcacaucaccugaucaccaacgaguaaaaaggaucguuuacgg 
Get sequence
Deep sequencing
464 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 8521746-8522119 [+]
intergenic
Database links

Mature sequence osa-miR1863a

Accession MIMAT0007813
Previous IDsosa-miR1863
Sequence

341 - 

agcucugauaccauguuagauuag

 - 364

Get sequence
Deep sequencing455 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).