Stem-loop sequence osa-MIR1862c

AccessionMI0008263 (change log)
DescriptionOryza sativa miR1862c stem-loop
Gene family MIPF0000580; MIR1862
Literature search

11 open access papers mention osa-MIR1862c
(14 sentences)

Stem-loop
   --    c                gu     c        uauau 
5'   acuc cuccgucccaaaauaa  caauc cguacuag     g
     |||| ||||||||||||||||  ||||| ||||||||     a
3'   ugag gaggcaggguuuuauu  guugg gcaugauc     c
   ga    a                ug     a        cuuca 
Get sequence
Deep sequencing
2428 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 16093884-16093972 [+]
intergenic
Database links

Mature sequence osa-miR1862c

Accession MIMAT0007812
Sequence

56 - 

acgagguugguuuauuuugggacg

 - 79

Get sequence
Deep sequencing2310 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).