Stem-loop sequence osa-MIR1862b

AccessionMI0008262 (change log)
DescriptionOryza sativa miR1862b stem-loop
Gene family MIPF0000344; MIR818
Literature search

11 open access papers mention osa-MIR1862b
(14 sentences)

Stem-loop
         uu     gaacau  -uu     c  -   g  ua       a                    ua   aa   u         a     ---   cg 
5' ggucau  agaua      gu   caucu ag ugc cc  cucccuu gucccaaaauaaauuaaucu  uac  gau uggcacauc uagua   cua  a
   ||||||  |||||      ||   ||||| || ||| ||  ||||||| ||||||||||||||||||||  |||  ||| ||||||||| |||||   |||   
3' ccagua  ucuau      ca   guagg uc aug gg  gagggag caggguuuuauuugguugga  aug  uua acuguguag aucau   ggu  a
         -c     -gacgc  ucc     c  u   a  --       g                    gc   cc   c         g     aua   cu 
Get sequence
Deep sequencing
2674 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 8341200-8341398 [-]
intergenic
Database links

Mature sequence osa-miR1862b

Accession MIMAT0007811
Sequence

132 - 

acgagguugguuuauuuugggacg

 - 155

Get sequence
Deep sequencing2327 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).