Stem-loop sequence osa-MIR1862a

AccessionMI0008261 (change log)
DescriptionOryza sativa miR1862a stem-loop
Gene family MIPF0000580; MIR1862
Literature search

11 open access papers mention osa-MIR1862a
(14 sentences)

Stem-loop
                          -    a      ---    cau 
5' guacucccuccgucccgaaauaa ccaa ccucgu   agga   g
   ||||||||||||||||||||||| |||| ||||||   ||||   u
3' uaugagggaggcaggguuuuauu gguu ggagca   uccu   c
                          u    -      uga    aca 
Get sequence
Deep sequencing
2557 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 26192308-26192395 [+]
intergenic
Database links

Mature sequence osa-miR1862a

Accession MIMAT0007810
Sequence

55 - 

acgagguugguuuauuuugggacg

 - 78

Get sequence
Deep sequencing2374 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).