Stem-loop sequence osa-MIR1861n

AccessionMI0008260 (change log)
DescriptionOryza sativa miR1861n stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861n
(47 sentences)

Stem-loop
   --    g          u     c        u           a     u      cuc  uuu 
5'   gcgu uuguauauuc uaggc cgaucuug ggcaggagcug guagc ggugaa   gc   a
     |||| |||||||||| ||||| |||||||| ||||||||||| ||||| ||||||   ||    
3'   ugua aacguauaag gucug gcuagaac cuguccuuggc caucg ucacuu   ug   u
   ag    -          u     a        c           a     c      acu  uug 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 16586544-16586672 [-]
intergenic
Database links

Mature sequence osa-miR1861n

Accession MIMAT0007809
Sequence

23 - 

cgaucuuguggcaggagcugag

 - 44

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).