Stem-loop sequence osa-MIR1861m

AccessionMI0008259 (change log)
DescriptionOryza sativa miR1861m stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861m
(47 sentences)

Stem-loop
   u         uuag  c                    a    uu  uu 
5'  ugcauauuc    gc cggucuuguggcaagaacug guag  cg  a
    |||||||||    || |||||||||||||||||||| ||||  ||   
3'  acguauaag    ug gccagaacacuguucuuggc cauu  gc  a
   a         uaua  a                    c    --  uc 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 13532649-13532744 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861m
osa-MIR1861lChr9: 13532426-13532554 [+]
osa-MIR1861mChr9: 13532649-13532744 [+]
osa-MIR1858aChr9: 13536611-13536810 [+]
Database links

Mature sequence osa-miR1861m

Accession MIMAT0007808
Sequence

18 - 

cggucuuguggcaagaacugag

 - 39

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).