Stem-loop sequence osa-MIR1861l

Accession

MI0008258 (change log)

Description

Oryza sativa miR1861l stem-loop

Gene family

MIPF0000567; MIR1861

Literature search

8 open access papers mention osa-MIR1861l
(47 sentences)

Stem-loop

      ug  -gc      u              a           a  a  u      cuc  ucu 
5' ucg  uu   auauuc uaggcccgaucuug ggcaggaacug gu gu ggugaa   gc   a
   |||  ||   |||||| |||||||||||||| ||||||||||| || || ||||||   ||    
3' agu  aa   uauaag gucugggcuagaac cuguccuuggc ca cg ucacuu   ug   u
      gu  aca      u              c           a  g  c      acu  uug 

Deep sequencing

190 reads, 50 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr9: 13532426-13532554 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR1861l

• osa-MIR1861l: Chr9: 13532426-13532554 [+]
• osa-MIR1861m: Chr9: 13532649-13532744 [+]
• osa-MIR1858a: Chr9: 13536611-13536810 [+]

Database links

• miRBase Tracker:MI0008258

Mature sequence osa-miR1861l

• Accession: MIMAT0007807
• Sequence: 23 - cgaucuugaggcaggaacugag - 44
• Deep sequencing: 186 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]
• Database links:
  • RNAcentral:URS00001FBCD0_39947

References

1. PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).