Stem-loop sequence osa-MIR1861k

AccessionMI0008257 (change log)
DescriptionOryza sativa miR1861k stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861k
(48 sentences)

Stem-loop
           u     c                    a     uc u 
5' gcauauuc uaggc cggucuuguggcaagaacug guagu  g u
   |||||||| ||||| |||||||||||||||||||| |||||  |  
3' cguauaag gucug gccagaacacuguucuuggc caucg  c a
           u     a                    g     cu a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 15132529-15132620 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861k
osa-MIR1861jChr8: 15132727-15132836 [-]
osa-MIR1861kChr8: 15132529-15132620 [-]
Database links

Mature sequence osa-miR1861k

Accession MIMAT0007806
Sequence

16 - 

cggucuuguggcaagaacugag

 - 37

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).