Stem-loop sequence osa-MIR1861j

AccessionMI0008256 (change log)
DescriptionOryza sativa miR1861j stem-loop
Gene family MIPF0000567; MIR1861
Literature search

9 open access papers mention osa-MIR1861j
(49 sentences)

Stem-loop
         u     cc       a           a  a  u       uc  ucu 
5' auauuc uaggc  ggucuug ggcaggaacug gu gu ggugaac  gc   a
   |||||| |||||  ||||||| ||||||||||| || || |||||||  ||    
3' uauaag gucug  ucggaac cuguccuugac ca cg ucacuug  ug   u
         u     aa       c           a  g  c       cu  uug 
Get sequence
Deep sequencing
242 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 15132727-15132836 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861j
osa-MIR1861jChr8: 15132727-15132836 [-]
osa-MIR1861kChr8: 15132529-15132620 [-]
Database links

Mature sequence osa-miR1861j

Accession MIMAT0007805
Sequence

14 - 

cggucuugaggcaggaacugag

 - 35

Get sequence
Deep sequencing242 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).