Stem-loop sequence osa-MIR1861i

AccessionMI0008255 (change log)
DescriptionOryza sativa miR1861i stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861i
(47 sentences)

Stem-loop
      c        a           a     u       uc  ucu 
5' ggc cgaucuug ggcaggaacug guagu ggugaac  gc   a
   ||| |||||||| ||||||||||| ||||| |||||||  ||    
3' cug gcuagaac cuguccuuggc caucg ucacuug  ug   u
      a        c           a     u       cu  uug 
Get sequence
Deep sequencing
189 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 14949509-14949600 [+]
intergenic
Database links

Mature sequence osa-miR1861i

Accession MIMAT0007804
Sequence

5 - 

cgaucuugaggcaggaacugag

 - 26

Get sequence
Deep sequencing185 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).