Stem-loop sequence osa-MIR1861h

AccessionMI0008254 (change log)
DescriptionOryza sativa miR1861h stem-loop
Gene family MIPF0000567; MIR1861
Literature search

10 open access papers mention osa-MIR1861h
(51 sentences)

Stem-loop
   u  u     c        a           a  a  u       uc  ucu 
5'  uc uaggc cggucuug ggcaggaacug gu gu ggugaac  gc   a
    || ||||| |||||||| ||||||||||| || || |||||||  ||    
3'  ag gucug gucagaac cuguccuuggc ca cg ucacuug  ug   u
   a  u     a        c           a  g  c       cu  uug 
Get sequence
Deep sequencing
250 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 27238190-27238293 [-]
intergenic
Database links

Mature sequence osa-miR1861h

Accession MIMAT0007803
Sequence

11 - 

cggucuugaggcaggaacugag

 - 32

Get sequence
Deep sequencing242 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).