Stem-loop sequence osa-MIR1861g

AccessionMI0008253 (change log)
DescriptionOryza sativa miR1861g stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861g
(47 sentences)

Stem-loop
   -   ug          u     c a                 ga     uc u 
5'  cgg  uugcauauuc uaggc c gucuuguggcaagaacu  guagu  g u
    |||  |||||||||| ||||| | |||||||||||||||||  |||||  |  
3'  guu  aacguauaag guccg g uagaacacuguucuugg  caucg  c a
   g   ga          u     a c                 ug     cu a 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 18668611-18668717 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861g
osa-MIR1861fChr5: 18668398-18668513 [+]
osa-MIR1861gChr5: 18668611-18668717 [+]
Database links

Mature sequence osa-miR1861g

Accession MIMAT0007802
Sequence

23 - 

cagucuuguggcaagaacugag

 - 44

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).