Stem-loop sequence osa-MIR1861f

AccessionMI0008252 (change log)
DescriptionOryza sativa miR1861f stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861f
(47 sentences)

Stem-loop
   u cg     u     c        a                 u u     uu  ucu 
5'  g  uauuc uaggc cgaucuug ggcaggaacugaguagu g ugaac  gc   a
    |  ||||| ||||| |||||||| ||||||||||||||||| | |||||  ||    
3'  c  auaag aucug gcuagaac cuguccuuggcuuauca c acuug  ug   u
   a au     u     a        c                 c c     cu  uug 
Get sequence
Deep sequencing
191 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 18668398-18668513 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861f
osa-MIR1861fChr5: 18668398-18668513 [+]
osa-MIR1861gChr5: 18668611-18668717 [+]
Database links

Mature sequence osa-miR1861f

Accession MIMAT0007801
Sequence

17 - 

cgaucuugaggcaggaacugag

 - 38

Get sequence
Deep sequencing186 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).