Stem-loop sequence osa-MIR1861e

AccessionMI0008251 (change log)
DescriptionOryza sativa miR1861e stem-loop
Gene family MIPF0000567; MIR1861
Literature search

9 open access papers mention osa-MIR1861e
(49 sentences)

Stem-loop
           u     c                    a     uc u 
5' gcauauuc uaggc cggucuuguggcaagaacug guagu  g u
   |||||||| ||||| |||||||||||||||||||| |||||  |  
3' cguauaag gucug gccagaacacuguucuuggc caucg  c a
           u     a                    g     cu a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 6536556-6536647 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861e
osa-MIR1861dChr4: 6536337-6536454 [+]
osa-MIR1861eChr4: 6536556-6536647 [+]
Database links

Mature sequence osa-miR1861e

Accession MIMAT0007800
Sequence

16 - 

cggucuuguggcaagaacugag

 - 37

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).