Stem-loop sequence osa-MIR1861d

AccessionMI0008250 (change log)
DescriptionOryza sativa miR1861d stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861d
(47 sentences)

Stem-loop
   u  c      u     c        a           a  a  u       uc  ucu 
5'  ug auauuc uaggc uggucuug ggcaggaacug gu gu ggugaac  gc   a
    || |||||| ||||| |||||||| ||||||||||| || || |||||||  ||    
3'  ac uauaag gucug gccagaac cuguccuuggc ca cg ucacuug  ug   u
   a  a      u     a        c           g  g  c       cu  uug 
Get sequence
Deep sequencing
111 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 6536337-6536454 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861d
osa-MIR1861dChr4: 6536337-6536454 [+]
osa-MIR1861eChr4: 6536556-6536647 [+]
Database links

Mature sequence osa-miR1861d

Accession MIMAT0007799
Sequence

18 - 

uggucuugaggcaggaacugag

 - 39

Get sequence
Deep sequencing104 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).