Stem-loop sequence osa-MIR1861c

AccessionMI0008249 (change log)
DescriptionOryza sativa miR1861c stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861c
(47 sentences)

Stem-loop
   -  g g          u   a c  a      ag         a     uc u 
5'  cg u uugcauauuc uag c cg ucuugu  caagaacug guagu  g u
    || | |||||||||| ||| | || ||||||  ||||||||| |||||  |  
3'  gu g aacguauaag guc g gc agaaca  guucuuggc caucg  c a
   g  g a          u   c a  c      cu         g     cu a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 20716174-20716280 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861c
osa-MIR1861bChr2: 20715962-20716079 [+]
osa-MIR1861cChr2: 20716174-20716280 [+]
Database links

Mature sequence osa-miR1861c

Accession MIMAT0007798
Sequence

23 - 

cgaucuuguagcaagaacugag

 - 44

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).