Stem-loop sequence osa-MIR1861b

AccessionMI0008248 (change log)
DescriptionOryza sativa miR1861b stem-loop
Gene family MIPF0000567; MIR1861
Literature search

9 open access papers mention osa-MIR1861b
(53 sentences)

Stem-loop
   u  c      u     c        a                 uc      uc  ucu 
5'  ug auauuc uaggc cgaucuug ggcaggaacugaguagu  gugaac  gc   a
    || |||||| ||||| |||||||| |||||||||||||||||  ||||||  ||    
3'  ac uauaag gucug gcuagaac cuguccuuggcuuauca  cacuug  ug   u
   a  a      u     a        c                 cc      cu  uug 
Get sequence
Deep sequencing
190 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 20715962-20716079 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1861b
osa-MIR1861bChr2: 20715962-20716079 [+]
osa-MIR1861cChr2: 20716174-20716280 [+]
Database links

Mature sequence osa-miR1861b

Accession MIMAT0007797
Sequence

18 - 

cgaucuugaggcaggaacugag

 - 39

Get sequence
Deep sequencing186 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).