Stem-loop sequence osa-MIR1861a

AccessionMI0008247 (change log)
DescriptionOryza sativa miR1861a stem-loop
Gene family MIPF0000567; MIR1861
Literature search

8 open access papers mention osa-MIR1861a
(50 sentences)

Stem-loop
   -uugug   c      u     c        a     a     a  a  u       uc  ucu 
5'       uug auauuc uaggc ugaucuug ggcag aacug gu gu ggugaac  gc   a
         ||| |||||| ||||| |||||||| ||||| ||||| || || |||||||  ||    
3'       aac uauaag aucug gcuagaac cuguc uuggc ca cg ucacuug  ug   u
   agugua   a      u     a        c     c     a  g  c       cu  uug 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 15049772-15049900 [+]
intergenic
Database links

Mature sequence osa-miR1861a

Accession MIMAT0007796
Sequence

23 - 

ugaucuugaggcagaaacugag

 - 44

Get sequence
Deep sequencing57 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).