Stem-loop sequence osa-MIR1860

AccessionMI0008245 (change log)
DescriptionOryza sativa miR1860 stem-loop
Literature search

4 open access papers mention osa-MIR1860
(4 sentences)

Stem-loop
   ucuu          ua   -----u                         -             -   auuugccuca 
5'     gauuugaugg  ggg      uaguguuauuuguaaagagaaaacc agcuuccagaucu cga          a
       ||||||||||  |||      ||||||||||||||||||||||||| ||||||||||||| |||          a
3'     cuggauuacc  ccc      aucacaauaaacauuucucuuuugg ucgaaggucuaga guu          c
   --gu          --   uuuuuu                         a             u   cucuucuauu 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 934420-934567 [-]
intergenic
Database links

Mature sequence osa-miR1860-5p

Accession MIMAT0007793
Sequence

38 - 

agaaaaccagcuuccagaucu

 - 58

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence osa-miR1860-3p

Accession MIMAT0007794
Sequence

91 - 

aucuggaagcuagguuuucucu

 - 112

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).