Stem-loop sequence osa-MIR1859

AccessionMI0008244 (change log)
DescriptionOryza sativa miR1859 stem-loop
Gene family MIPF0000745; MIR2118
Literature search

1 open access papers mention osa-MIR1859
(2 sentences)

Stem-loop
   --      ug a          -     a       a g     ugaacc 
5'   gggagu  u ggaauggaug cguag gaaagaa u aaauc      a
     ||||||  | |||||||||| ||||| ||||||| | |||||       
3'   ccuuua  a ccuuaccugc guauc cuuucuu a uuuag      g
   ga      gu a          a     -       - g     uguuua 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 673278-673374 [-]
intergenic
Database links

Mature sequence osa-miR1859

Accession MIMAT0007792
Sequence

66 - 

uuuccuaugacguccauuccaa

 - 87

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).