Stem-loop sequence osa-MIR1846b

AccessionMI0008243 (change log)
DescriptionOryza sativa miR1846b stem-loop
Gene family MIPF0000577; MIR1846
Literature search

7 open access papers mention osa-MIR1846b
(8 sentences)

Stem-loop
   -c  c   cuaccaau    cg        c  a        gc     c     g 
5'   cg ucc        gagc  ccggaucu cc gugaggag  cgggg cgcug a
     || |||        ||||  |||||||| || ||||||||  ||||| |||||  
3'   gc agg        cucg  ggccuagg gg cgcuccuc  gcccc gugac u
   ga  a   aaagagac    -a        c  c        uu     a     c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 27715822-27715933 [-]
intergenic
Database links

Mature sequence osa-miR1846b-5p

Accession MIMAT0007790
Sequence

33 - 

agugaggaggccggggccgcu

 - 53

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

Mature sequence osa-miR1846b-3p

Accession MIMAT0007791
Sequence

62 - 

ugaccccguucuccucgccgg

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).