Stem-loop sequence osa-MIR1846a

AccessionMI0008242 (change log)
DescriptionOryza sativa miR1846a stem-loop
Gene family MIPF0000577; MIR1846
Literature search

6 open access papers mention osa-MIR1846a
(7 sentences)

Stem-loop
   -c  c   cuaccaau    c         c  a        gc     c     g 
5'   cg ucc        gagc gccggaucu cc gugaggag  cgggg cgcug a
     || |||        |||| ||||||||| || ||||||||  ||||| |||||  
3'   gc agg        cucg cggccuagg gg cgcuccuc  gcccc guggc u
   ga  a   aaagagac    -         c  c        uu     a     c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 529274-529385 [+]
intergenic
Database links

Mature sequence osa-miR1846a-5p

Accession MIMAT0007788
Sequence

33 - 

agugaggaggccggggccgcu

 - 53

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

Mature sequence osa-miR1846a-3p

Accession MIMAT0007789
Sequence

62 - 

ugaccccguucuccucgccgg

 - 82

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).