Stem-loop sequence osa-MIR1428d

AccessionMI0008238 (change log)
DescriptionOryza sativa miR1428d stem-loop
Gene family MIPF0000575; MIR1428
Literature search

5 open access papers mention osa-MIR1428d
(24 sentences)

Stem-loop
       a ug               ca   cc   a        u aa  g    --   g     
5' gguu g  uacuuugcgaauuca  ggc  uau uuguggua g  cu agua  cgc auga 
   |||| |  |||||||||||||||  |||  ||| |||||||| |  || ||||  ||| ||| u
3' ccaa c  gugaaacgcuuaagu  ccg  aua aauaccau c  gg uuau  gug uauu 
       a uu               -a   ua   g        u gg  g    ac   g     
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 23077268-23077391 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1428d
osa-MIR1428eChr3: 23076870-23076979 [+]
osa-MIR1428dChr3: 23077268-23077391 [+]
Database links

Mature sequence osa-miR1428d

Accession MIMAT0007783
Sequence

89 - 

uaagauaaugccaugaauucg

 - 109

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).