Stem-loop sequence osa-MIR1428c

AccessionMI0008237 (change log)
DescriptionOryza sativa miR1428c stem-loop
Gene family MIPF0000575; MIR1428
Literature search

5 open access papers mention osa-MIR1428c
(21 sentences)

Stem-loop
           a    a u                ca   cc    c       u aa  g    --   g     
5' gcuucagu gguu g gcacuuugcgaauucg  ggc  uauc uguggua g  cu agua  cgc auaa 
   |||||||| |||| | ||||||||||||||||  |||  |||| ||||||| |  || ||||  ||| ||| u
3' ugaaguca ccaa c ugugaaacgcuuaagu  ccg  auag auaccau c  gg uuau  gug uauu 
           c    a u                -a   ua    a       u gg  a    ac   g     
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 2535020-2535161 [+]
intergenic
Database links

Mature sequence osa-miR1428c

Accession MIMAT0007782
Sequence

98 - 

uaagauaaugccaugaauucg

 - 118

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).