Stem-loop sequence osa-MIR1428b

AccessionMI0008235 (change log)
DescriptionOryza sativa miR1428b stem-loop
Gene family MIPF0000575; MIR1428
Literature search

5 open access papers mention osa-MIR1428b
(20 sentences)

Stem-loop
       a u                cg   c             u aa  g    c   auga 
5' gguu g gcgcuuugcgaauuca  ggu uuaucuuguggua g  cu agua gua    u
   |||| | ||||||||||||||||  ||| ||||||||||||| |  || |||| |||    u
3' ccaa c ugcgaaacgcuuaagu  ccg aauagaauaccau c  gg uuau cgu    u
       a u                -a   u             u gg  g    a   ggua 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 25390346-25390469 [+]
intergenic
Database links

Mature sequence osa-miR1428b

Accession MIMAT0007781
Sequence

89 - 

uaagauaaugccaugaauucg

 - 109

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).