Stem-loop sequence osa-MIR1857

AccessionMI0008234 (change log)
DescriptionOryza sativa miR1857 stem-loop
Literature search

3 open access papers mention osa-MIR1857
(8 sentences)

Stem-loop
   --g                                       a      ---------ccg     aaa 
5'    uuuuuauccugguuuuuuuggagcaugagguuaucucuc guuuuu            ugucc   a
      ||||||||||||||||||||||||||||||||||||||| ||||||            |||||   u
3'    aaaaauaggaccaaaagaaccucguacuccaauagagag caaaag            acagg   a
   uua                                       c      uucuugucaaaa     aaa 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 2733902-2734031 [+]
intergenic
Database links

Mature sequence osa-miR1857-5p

Accession MIMAT0007779
Sequence

11 - 

ugguuuuuuuggagcaugagg

 - 31

Get sequence
Deep sequencing24 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

Mature sequence osa-miR1857-3p

Accession MIMAT0007780
Sequence

100 - 

ucaugcuccaagaaaaccagg

 - 120

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).