Stem-loop sequence osa-MIR1853

AccessionMI0008230 (change log)
DescriptionOryza sativa miR1853 stem-loop
Literature search

2 open access papers mention osa-MIR1853
(2 sentences)

Stem-loop
                 uu a                  c  cucc 
5' cgcaacuucgagca  c aacauucccaauuaccau gc    c
   ||||||||||||||  | |||||||||||||||||| ||    u
3' gcguuggagcucgu  g uuguagggguuaauggua cg    a
                 ug c                  a  acaa 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3689091-3689179 [-]
intergenic
Database links

Mature sequence osa-miR1853-5p

Accession MIMAT0007773
Sequence

11 - 

agcauucaaacauucccaauuacc

 - 34

Get sequence
Evidence experimental; 454 [1]

Mature sequence osa-miR1853-3p

Accession MIMAT0007774
Sequence

58 - 

uaauuggggauguucgguugcu

 - 79

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).