Stem-loop sequence osa-MIR1852

AccessionMI0008229 (change log)
DescriptionOryza sativa miR1852 stem-loop
Literature search

2 open access papers mention osa-MIR1852
(2 sentences)

Stem-loop
   ua   u      c         a                   aaauugaacuccgugcacgguagu 
5'   gac aacuac ccugcauuc gaauucauauagcgauuga                        a
     ||| |||||| ||||||||| |||||||||||||||||||                        g
3'   uug uugaug ggacguaag cuuagguauaucguuaacu                        u
   ac   u      u         a                   aaucuuuguuaucuagacugauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 20761025-20761159 [+]
intergenic
Database links

Mature sequence osa-miR1852

Accession MIMAT0007772
Sequence

103 - 

auauggauucagaaugcaggu

 - 123

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).