Stem-loop sequence osa-MIR1850

AccessionMI0008227 (change log)
DescriptionOryza sativa miR1850 stem-loop
Literature search

7 open access papers mention osa-MIR1850
(15 sentences)

Stem-loop
          g a    c                a          -   u              u  au 
5' augugau g gaug gauggaaaguugggag uugggggaag uug gugugaacuaaacg gg  u
   ||||||| | |||| |||||||||||||||| |||||||||| ||| |||||||||||||| ||  g
3' uacacua c cuac cuacuuuucaacccuu aaccuccuuc aac uacacuugauuugu cc  g
          a a    a                a          u   -              c  gg 
Get sequence
Deep sequencing
702 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 26275207-26275339 [-]
intergenic
Database links

Mature sequence osa-miR1850.1

Accession MIMAT0007770
Previous IDsosa-miR1850
Sequence

18 - 

uggaaaguugggagauugggg

 - 38

Get sequence
Deep sequencing646 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [3]
Database links

Mature sequence osa-miR1850.2

Accession MIMAT0009210
Sequence

43 - 

uugugugugaacuaaacgugg

 - 63

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [2-3]

Mature sequence osa-miR1850.3

Accession MIMAT0009211
Sequence

73 - 

cuguuuaguucacaucaaucuu

 - 94

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [2-3]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).