Stem-loop sequence osa-MIR1849

AccessionMI0008226 (change log)
DescriptionOryza sativa miR1849 stem-loop
Literature search

2 open access papers mention osa-MIR1849
(2 sentences)

Stem-loop
                              a         uc  g u 
5' aaauaagcuaaccuaggauaugauggg cauuaccua  ua a u
   ||||||||||||||||||||||||||| |||||||||  || | c
3' uuuauuugguuggauccuaugcuaucc guaauggau  au u g
                              c         -c  g u 
Get sequence
Deep sequencing
409 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 22224813-22224902 [+]
intergenic
Database links

Mature sequence osa-miR1849

Accession MIMAT0007769
Sequence

66 - 

uaucguauccuagguugguuu

 - 86

Get sequence
Deep sequencing34 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).