Stem-loop sequence osa-MIR1847

AccessionMI0008224 (change log)
DescriptionOryza sativa miR1847 stem-loop
Literature search

5 open access papers mention osa-MIR1847
(5 sentences)

Stem-loop
      cu    a        c                        a         c 
5' aga  cccu acuuugug aguuugcaguuguggcacugacau ugggccaga a
   |||  |||| |||||||| |||||||||||||||||||||||| |||||||||  
3' ucu  ggga ugaaauac ucaaacgucaacaccgugauugua acccgguuu c
      ag    c        a                        c         a 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 20332878-20332987 [+]
intergenic
Database links

Mature sequence osa-miR1847.1

Accession MIMAT0007766
Sequence

17 - 

ugcaguuugcaguuguggcac

 - 37

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence osa-miR1847.2

Accession MIMAT0007767
Sequence

60 - 

uggcccacauguuagugccacaac

 - 83

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).