Stem-loop sequence osa-MIR1846d

AccessionMI0008223 (change log)
DescriptionOryza sativa miR1846d stem-loop
Gene family MIPF0000577; MIR1846
Literature search

9 open access papers mention osa-MIR1846d
(11 sentences)

Stem-loop
   u  -  -         ac  a  a       cu -  a     u     c   c    ag 
5'  gc cu gucccuccc  cg gc gccggau  c cc gugag aggcc ggg cgcc  a
    || || |||||||||  || || |||||||  | || ||||| ||||| ||| ||||   
3'  cg ga cagggaggg  gc cg cggccua  g gg cgcuc ucugg ccc gugg  u
   c  a  g         ac  -  -       -u u  c     c     c   a    cc 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 39637065-39637180 [+]
intergenic
Database links

Mature sequence osa-miR1846d-5p

Accession MIMAT0007764
Sequence

11 - 

ucccaccgagcagccggaucuc

 - 32

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence osa-miR1846d-3p

Accession MIMAT0007765
Sequence

87 - 

uauccggcgccgcagggagg

 - 106

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).