Stem-loop sequence ssc-mir-221

AccessionMI0008221 (change log)
DescriptionSus scrofa miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

23 open access papers mention ssc-mir-221
(82 sentences)

Stem-loop
   ----u     ug   u         auuu    -   u 
5'      gaacc  gca acaauguag    cugu guu g
        |||||  ||| |||||||||    |||| ||| u
3'      uuugg  cgu uguuacauc    gaca cgg u
   cggac     gu   c         ----    a   g 
Get sequence
Deep sequencing
16213 reads, 2.91e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 45274873-45274942 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-221
ssc-mir-222chrX: 45275613-45275692 [-]
ssc-mir-221chrX: 45274873-45274942 [-]
Database links

Mature sequence ssc-miR-221-5p

Accession MIMAT0022949
Sequence

4 - 

accuggcauacaauguagauuucugu

 - 29

Get sequence
Deep sequencing953 reads, 15 experiments
Evidence experimental; Illumina [3]

Mature sequence ssc-miR-221-3p

Accession MIMAT0007762
Previous IDsssc-miR-221
Sequence

44 - 

agcuacauugucugcuggguuu

 - 65

Get sequence
Deep sequencing15254 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-4]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).