Stem-loop sequence ssc-mir-199b

AccessionMI0008219 (change log)
DescriptionSus scrofa miR-199b stem-loop
Gene family MIPF0000040; mir-199
Literature search

12 open access papers mention ssc-mir-199b
(15 sentences)

Stem-loop
     -     c       u       u    u  ----  a 
5' cc gucua ccagugu uagacua cugu ca    gg c
   || ||||| ||||||| ||||||| |||| ||    ||  
3' gg cggau gguuaca gucugau gaca gu    cc u
     u     u       c       -    u  uaaa  c 
Get sequence
Deep sequencing
38416 reads, 6.21e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 302681826-302681899 [-]
sense
ENSSSCT00000021339 ; ssc-mir-199b.1-201; exon 1
antisense
ENSSSCT00000006203 ; DNM1-201; intron 17
Clustered miRNAs
< 10kb from ssc-mir-199b
ssc-mir-9822chr1: 302681896-302681971 [-]
ssc-mir-199bchr1: 302681826-302681899 [-]
Database links

Mature sequence ssc-miR-199b-5p

Accession MIMAT0017339
Previous IDsssc-miR-199b
Sequence

8 - 

cccaguguuuagacuaucuguu

 - 29

Get sequence
Deep sequencing6036 reads, 15 experiments
Evidence experimental; cloned [3], Illumina [4-5]

Mature sequence ssc-miR-199b-3p

Accession MIMAT0007760
Previous IDsssc-miR-199b*
Sequence

46 - 

uacaguagucugcacauugguu

 - 67

Get sequence
Deep sequencing32379 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2,4-5]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).