Stem-loop sequence ssc-mir-34a

AccessionMI0008216 (change log)
DescriptionSus scrofa miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

15 open access papers mention ssc-mir-34a
(72 sentences)

Stem-loop
   -u    uu     ug -  ua          ----g  agu 
5'   uucu  ggcag  u cu  gcugguuguu     ug   a
     ||||  |||||  | ||  ||||||||||     ||    
3'   aaga  ccguc  a ga  cgacuaacga     ac   a
   ac    uc     cu c  --          aggaa  gau 
Get sequence
Deep sequencing
150 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-34a

Accession MIMAT0007757
Sequence

7 - 

uggcagugucuuagcugguugu

 - 28

Get sequence
Deep sequencing150 reads, 13 experiments
Evidence experimental; cloned [1-2], Illumina [3]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).