Stem-loop sequence ssc-mir-17

AccessionMI0008214 (change log)
DescriptionSus scrofa miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

30 open access papers mention ssc-mir-17
(81 sentences)

Stem-loop
   ga       -ca        a  g     g   -  aua 
5'   auaaugu   aagugcuu ca ugcag uag ug   a
     |||||||   |||||||| || ||||| ||| ||    
3'   uauuacg   uucacgga gu acguc auc ac   u
   gg       aug        a  g     -   u  gug 
Get sequence
Deep sequencing
5108 reads, 647 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 66610060-66610136 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-17
ssc-mir-17chr11: 66610060-66610136 [+]
ssc-mir-18achr11: 66610195-66610286 [+]
ssc-mir-19achr11: 66610343-66610424 [+]
ssc-mir-20achr11: 66610513-66610583 [+]
ssc-mir-19b-1chr11: 66610642-66610721 [+]
ssc-mir-92a-1chr11: 66610762-66610841 [+]
Database links

Mature sequence ssc-miR-17-5p

Accession MIMAT0007755
Previous IDsssc-miR-17
Sequence

10 - 

caaagugcuuacagugcagguag

 - 32

Get sequence
Deep sequencing4969 reads, 15 experiments
Evidence experimental; cloned [1,3], Illumina [2,4-5]

Mature sequence ssc-miR-17-3p

Accession MIMAT0015268
Sequence

48 - 

acugcagugaaggcacuuguag

 - 69

Get sequence
Deep sequencing139 reads, 14 experiments
Evidence experimental; Illumina [2,4-5]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).