Stem-loop sequence ssc-mir-16-1

AccessionMI0008213 (change log)
Previous IDsssc-mir-16-2
DescriptionSus scrofa miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

22 open access papers mention ssc-mir-16-1
(47 sentences)

Stem-loop
   uc    cu         ua        c  --    aa 
5'   cgcu  agcagcacg  aauauugg gu  agua  a
     ||||  |||||||||  |||||||| ||  ||||  u
3'   gcga  ucgucgugu  uuauaacc ca  uuau  a
   gu    uu         ua        a  aa    aa 
Get sequence
Deep sequencing
8978 reads, 1.56e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 108388290-108388366 [+]
sense
ENSSSCT00000012842 ; SMC4-201; intron 5
Clustered miRNAs
< 10kb from ssc-mir-16-1
ssc-mir-15bchr13: 108388133-108388230 [+]
ssc-mir-16-1chr13: 108388290-108388366 [+]
Database links

Mature sequence ssc-miR-16

Accession MIMAT0007754
Sequence

8 - 

uagcagcacguaaauauuggcg

 - 29

Get sequence
Deep sequencing16097 reads, 15 experiments
Evidence experimental; cloned [1,3], Illumina [2,4-5]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).