Stem-loop sequence ssc-mir-15a

AccessionMI0008211 (change log)
DescriptionSus scrofa miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

20 open access papers mention ssc-mir-15a
(90 sentences)

Stem-loop
   uuggaguaaa ua        ua          ga  u 
5'           g  gcagcaca  augguuugug  uu u
             |  ||||||||  ||||||||||  || g
3'           c  cgucgugu  uaccggacgu  aa a
   aacauaaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
1566 reads, 100 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf2048: 70414-70492 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-15a
ssc-mir-15achrUScaf2048: 70414-70492 [+]
ssc-mir-16-2chrUScaf2048: 70557-70635 [+]
Database links

Mature sequence ssc-miR-15a

Accession MIMAT0007753
Sequence

12 - 

uagcagcacauaaugguuugu

 - 32

Get sequence
Deep sequencing1561 reads, 14 experiments
Evidence experimental; cloned [1,3], Illumina [2,4-5]

References

1
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).