Stem-loop sequence gga-mir-124a-2

AccessionMI0008210 (change log)
DescriptionGallus gallus miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

12 open access papers mention gga-mir-124a-2
(36 sentences)

Stem-loop
   ---------cc   - cu      - c        a   ga        uaaug 
5'            gag c  cucucu g guguucac gcg  ccuugauu     u
              ||| |  |||||| | |||||||| |||  ||||||||      
3'            cuc g  gagaga c cguaagug cgc  ggaauuaa     c
   uuacuucgaca   c ag      a -        g   ac        cauac 
Get sequence
Deep sequencing
182533 reads, 1.42e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 8883886-8883983 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-124a-2
gga-mir-12242chr20: 8883519-8883579 [+]
gga-mir-124a-2chr20: 8883886-8883983 [+]
Database links

Mature sequence gga-miR-124a-5p

Accession MIMAT0026511
Sequence

19 - 

guucacagcggaccuugau

 - 37

Get sequence
Deep sequencing998 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-124a-3p

Accession MIMAT0001128
Sequence

53 - 

uuaaggcacgcggugaaugcca

 - 74

Get sequence
Deep sequencing364040 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).