Stem-loop sequence cel-mir-1833

AccessionMI0008203 (change log)
DescriptionCaenorhabditis elegans miR-1833 stem-loop
Stem-loop
   --       c                  --      u 
5'   acgcuua uucgcaagccucgcgcgu  uuucuu u
     ||||||| ||||||||||||||||||  |||||| c
3'   ugugaau aagcguucggagcgugcg  aaagag a
   cg       a                  aa      a 
Get sequence
Deep sequencing
193 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 15012347-15012419 [-]
sense
Y41E3.4a ; Y41E3.4a; intron 2
Y41E3.4b.1 ; Y41E3.4b.1; intron 3
Y41E3.4b.2 ; Y41E3.4b.2; intron 3
antisense
Y41E3.458 ; Y41E3.458; exon 1
Database links

Mature sequence cel-miR-1833

Accession MIMAT0006775
Sequence

51 - 

cgaggcuugcgaaauaagugugc

 - 73

Get sequence
Deep sequencing146 reads, 13 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).