Stem-loop sequence cel-mir-1832a

AccessionMI0008202 (change log)
Previous IDscel-mir-1832
DescriptionCaenorhabditis elegans miR-1832 stem-loop
Stem-loop
   --  g       aa           --g  -  u 
5'   ca cgauucg  cuccgcccacu   ca cc g
     || |||||||  |||||||||||   || || a
3'   gu gcuaagc  gaggcggguga   gu gg u
   ua  a       --           aca  u  u 
Get sequence
Deep sequencing
8602 reads, 13.3 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 11829248-11829311 [+]
sense
C18D11.4a.1 ; C18D11.4a.1; intron 3
C18D11.4a.2 ; C18D11.4a.2; intron 3
Database links

Mature sequence cel-miR-1832a-5p

Accession MIMAT0032039
Sequence

1 - 

cagcgauucgaacuccgcccacu

 - 23

Get sequence
Deep sequencing213 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-1832a-3p

Accession MIMAT0006774
Previous IDscel-miR-1832a
Sequence

44 - 

ugggcggagcgaaucgaugau

 - 64

Get sequence
Deep sequencing8228 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2